90
|
Promega
pgem-t easy vector Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem-t easy vector/product/Promega Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem -t easy-shuttle vector Pgem T Easy Shuttle Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem -t easy-shuttle vector/product/Promega Average 90 stars, based on 1 article reviews
pgem -t easy-shuttle vector - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
tiangen biotech co
pgemt easy vectors Pgemt Easy Vectors, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgemt easy vectors/product/tiangen biotech co Average 90 stars, based on 1 article reviews
pgemt easy vectors - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
recombinant pgem t-vectors Recombinant Pgem T Vectors, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant pgem t-vectors/product/Promega Average 90 stars, based on 1 article reviews
recombinant pgem t-vectors - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
pgem-3zf Pgem 3zf, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem-3zf/product/Sangon Biotech Average 90 stars, based on 1 article reviews
pgem-3zf - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t vector manual  Pgem T Vector Manual, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem-t vector manual/product/Promega Average 90 stars, based on 1 article reviews
pgem-t vector manual - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem®-t basic vector Pgem® T Basic Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem®-t basic vector/product/Promega Average 90 stars, based on 1 article reviews
pgem®-t basic vector - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Lucigen Corp
pgem-t easy vector Pgem T Easy Vector, supplied by Lucigen Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem-t easy vector/product/Lucigen Corp Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
sequencing vector pgemt easy Sequencing Vector Pgemt Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequencing vector pgemt easy/product/Promega Average 90 stars, based on 1 article reviews
sequencing vector pgemt easy - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgemt easy cloning vector Pgemt Easy Cloning Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgemt easy cloning vector/product/Promega Average 90 stars, based on 1 article reviews
pgemt easy cloning vector - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
pgem-t vitro transcription vector Pgem T Vitro Transcription Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgem-t vitro transcription vector/product/Promega Average 90 stars, based on 1 article reviews
pgem-t vitro transcription vector - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
recombinant dna reagent pgem-t easy Recombinant Dna Reagent Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant dna reagent pgem-t easy/product/Promega Average 90 stars, based on 1 article reviews
recombinant dna reagent pgem-t easy - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Microorganisms
Article Title: Sulfur Oxygenase Reductase (Sor) in the Moderately Thermoacidophilic Leaching Bacteria: Studies in Sulfobacillus thermosulfidooxidans and Acidithiobacillus caldus
doi: 10.3390/microorganisms3040707
Figure Lengend Snippet: Polymerase chain reaction (PCR) primers used in this study.
Article Snippet: T7 , taatacgactcactataggg , Promoterregions , 158 bp ,
Techniques: Polymerase Chain Reaction, Sequencing, Amplification, Plasmid Preparation